2019-02-19 19:32:472025-05-11 08:58:00
description
alpha-phosphoglucomutase, required for UDP-glucose synthesis, inhibits [[protein|FtsZ]] ring assembly (indirect effect due to a defect in UDP-glucose synthesis)
alpha-phosphoglucomutase, required for UDP-glucose synthesis, inhibits [[protein|FtsZ]] ring assembly (indirect effect due to a defect in UDP-glucose synthesis), possesses a secondary phosphoglucosamine mutase activity
locus
BSU09310
BSU_09310
outlinks
bsu
BSU09310
BSU_09310
Gene
Phenotypes of a mutant
cells are bent and distended due to the lack of glucolipids [Pubmed|27684739]
the inactivation of ''[[gene|pgcA]]'' suppresses the poor and filamentous growth of the ''[[gene|whiA]] [[gene|zapA]]'' double mutant [Pubmed|24097947]
inactivation of ''[[gene|pgcA]]'' reduces sporulation efficiency to 0.1% that of wild type cells; smaller and wider mother cells with small forespores [Pubmed|26735940]
cells are bent and distended due to the lack of glucolipids [Pubmed|27684739]
the inactivation of ''[[gene|pgcA]]'' suppresses the poor and filamentous growth of the ''[[gene|whiA]] [[gene|zapA]]'' double mutant [Pubmed|24097947]
inactivation of ''[[gene|pgcA]]'' reduces sporulation efficiency to 0.1% that of wild type cells; smaller and wider mother cells with small forespores [Pubmed|26735940]
resistant to phage SPO1 [pubmed|30811056]
a [[gene|pgcA]] [[gene|glmR]] double mutant is not viable, this can be suppressed by overexpression of [[protein|GlmM]] [pubmed|31589605]
The protein
Catalyzed reaction/ biological activity
Alpha-D-glucose 1-phosphate = alpha-D-glucose 6-phosphate (according to Swiss-Prot)
α-D-glucose 1-phosphate --> α-D-glucose 6-phosphate (according to UniProt)
D-glucosamine 6-phosphate --> α-D-glucosamine 1-phosphate (secondary activity, this activity is increased by a G47S mutation) [pubmed|31589605]
The protein
Protein family
phosphohexose mutase family [pubmed|15238632]
phosphohexose mutase family (with [[protein|GlmM]], [pubmed|15238632])
The protein
Additional information
PgcA inhibits [[protein|FtsZ]] ring assembly (indirect effect due to a defect in UDP-glucose synthesis)[Pubmed|17662947]
PgcA inhibits [[protein|FtsZ]] ring assembly (indirect effect due to a defect in UDP-glucose synthesis)[Pubmed|17662947]
a PgcA (G47S) variant suppresses the growth defect of a [[gene|glmR]] mutant on gluconeogenic carbon sources in the absence of glucose due to the increased phosphoglucosamine mutase activity [pubmed|31589605]
Biological materials
Mutant
MGNA-B476 (yhxB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1475 NBRP B. subtilis, Japan]
GP1743: BSB1 ''pgcA::aphA3'', available in [SW|Jrg Stlke]' lab
BKE09310 ([[gene|pgcA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGTCCTCCTATGTA, downstream forward: _UP4_TAATTCAAGTATGAGCTGGG
BKK09310 ([[gene|pgcA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGTCCTCCTATGTA, downstream forward: _UP4_TAATTCAAGTATGAGCTGGG
MGNA-B476 (yhxB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1475 NBRP B. subtilis, Japan]
GP1743: BSB1 ''pgcA::aphA3'', available in [SW|Jörg Stülke]'s lab
BKE09310 ([[gene|pgcA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGTCCTCCTATGTA, downstream forward: _UP4_TAATTCAAGTATGAGCTGGG
BKK09310 ([[gene|pgcA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGTCCTCCTATGTA, downstream forward: _UP4_TAATTCAAGTATGAGCTGGG
References
Original publications